Journal: Nature

Article Title: Hippo signalling maintains ER expression and ER + breast cancer growth.

doi: 10.1038/s41586-020-03131-5

Figure Lengend Snippet: Fig. 1 | LATS is essential to maintaining ER expression. a, Deletion of LATS1/2 causes an enrichment of YAP target-gene signature and depletion of ERα target-gene signature. NES, normalized enrichment score. b, c, LATS1/2 double knockout (dKO) downregulates ESR1 mRNA (b) and ERα protein (c) in MCF-7 cells. Two independent LATS1/2 double-knockout MCF-7 clones are shown (labelled no. 1 and no. 2). pYAP (S127), YAP phosphorylated at S127. WT, wild type. d, LATS1/2 double knockout inhibits target genes of ERα, with (+E2) or without (−E2) treatment with oestradiol (E2) (1 nM) for 45 min. e, LATS1/2 deficiency downregulates ERα. T47D (left) and ZR-75-1 (right) cells with lentivirus-mediated CRISPR deletion of LATS1/2 (single-guide RNA against LATS1/2 (sgLATS1/2)) were subjected to immunoblot analysis with indicated antibodies. No. 1 and no. 2 denote two independent clones of each cell line. f–h, Deletion of Lats1/2 activates YAP and TAZ, and downregulates Esr1 expression, in mouse mammary organoids. Organoids derived from the mammary tissues of Lats1+/+Lats2+/+ and Lats1fl/flLats2fl/fl mice were infected with Cre-encoding adenovirus and subjected to immunohistochemistry (f), immunoblot (g) and qPCR analysis (h). Scale bar, 50 μm. i, LATS1

Article Snippet: Those for ERα (mouse) (no. sc-542), YAP and TAZ (no. sc-101199) and GAPDH (no. sc-25778) were obtained from Santa Cruz Biotechnology.

Techniques: Expressing, Double Knockout, Clone Assay, CRISPR, Western Blot, Derivative Assay, Infection, Immunohistochemistry

Journal: bioRxiv

Article Title: Integrin-TGFβ axis induces partial EMT in basal-like cells to lead collective invasion

doi: 10.1101/2025.04.04.647177

Figure Lengend Snippet: (A) Confocal imaging of ITGα2, Vimentin, and K8 in an IDC patient tissue section. Green contour: cluster of cancer cells with protrusive morphology; green arrowheads: basal-like cells (K8-low) at the tumor–stroma interface with high ITGα2 expression. White contour: cluster of cancer cells lacking basal-like cells (K8-high), with low ITGα2 expression; magenta arrowheads. White arrowheads: fibroblast-like cells (elongated, spindle-shaped). (B) Quantification of mean gray values for ITGα2 and Vimentin in basal-like (n = 33), luminal-like (n = 32), and fibroblast-like (n = 32) cells from one IDC patient tissue section. (C) Representative brightfield images of MMTV-PyMT organoids (ITGα2-WT or ITGα2-KO, gRNA1 and gRNA2) cultured in 3D Collagen I. Black arrowheads: invasive strands. (D) Percentage of organoids exhibiting one or more invasive strands in ITGα2-WT and ITGα2-KO (clones 1 and 2 from gRNA1) MMTV-PyMT organoids. (E) qPCR analysis of classical TGF-β and EMT target genes in ITGα2-WT and ITGα2-KO MMTV-PyMT organoids cultured in 3D Collagen I for three days. Values represent mean normalized mRNA expression (relative to housekeeping genes), shown for KO organoids relative to WT controls (dashed line). Data are presented as mean ± SD from three independent experiments. (F) Confocal imaging of Col ¾ and F-actin in ITGα2-WT and ITGα2-KO MMTV-PyMT organoids after one day in 3D Collagen I. (G, H) qPCR analysis of Vimentin and Slug mRNA expression in ITGα2-KO versus ITGα2-WT MMTV-PyMT organoids treated with Activin A (20 ng/μl) or vehicle control (0.1% BSA) for three days. Bar graphs represent mean normalized expression values ± SD from four independent experiments. (I) Kaplan–Meier analysis correlating high vs. low mRNA expression of INHBA, ITGA2, ITGB1, and their combinations (ITGA2 + ITGB1, or INHBA + ITGA2 + ITGB1) with distant metastasis-free survival (DMFS) in patients with grade 3 breast cancer. Scale bars: 100 μm (A, C), 50 μm (A, zoom-in), 50 μm (F), 10 μm (F, zoom-in). P values: two-sided unpaired Mann–Whitney test (E), two-sided Kruskal-Wallis test with Dunn’s multiple comparisons (G, H), Log-rank test (I).

Article Snippet: The following antibodies were used: rabbit anti-human Vimentin (Cat#ab92547, Abcam), chicken anti-human Vimentin (Cat#PA1-16759, Invitrogen) rabbit anti-human Keratin 14 (Cat# 905301, Biolegend), rat anti-mouse Keratin 8 (Cat# 531826, DSHB), rabbit anti-rat Collagen I cleavage site (Col ¾, Cat#0217-025, immunoGlobe), rabbit anti-human integrin α2 (Cat#ab181548, Abcam), rabbit anti-human Inhba (Cat#10651-1-AP, Proteintech), Mouse IgG1 isotype control (MAB002, R&D Systems), anti-Activin A antibody (Cat#AF338, R&D Systems).

Techniques: Imaging, Expressing, Cell Culture, Clone Assay, Control, MANN-WHITNEY

Journal: bioRxiv

Article Title: Integrin-TGFβ axis induces partial EMT in basal-like cells to lead collective invasion

doi: 10.1101/2025.04.04.647177

Figure Lengend Snippet: (A) DNA sequence of the Itgα2 gene to confirm gene knockout by Crispr-Cas9 gene editing. Red regions indicate the insertion of one base pair compared to the wildtype Itgα2 sequence. (B) Western blot analysis showing Itgα2 and GAPDH expression from whole cell lysates of MMTV-PyMT organoids WT or KO (gRNA1 or gRNA2). (C) Confocal imaging of Itgα2 and K8 in MMTV-PyMT organoids with Itgα2 WT or knockout (KO) grown in Collagen I for 3 days. White arrowheads: invading strands in Itgα2 WT organoids led by basal-like cells (low K8, high Itgα2, insets), White arrows: non-invading basal-like cells at the ECM interface in Itgα2 KO organoids (low K8, low Itgα2, insets). (D) Percentage of invasive organoids in MMTV-PyMT organoids Itgα2-WT versus Itgα2-KO (gRNA2). (E) Mean gray value of Col ¾ relative to Collagen I reflection in MMTV-PyMT organoids with Itgα2-WT and Itgα2-KO. Median: red lines, from n = 11 organoids per group from two independent experiments. (F) Single confocal slice showing INHBA and K8 expression in Itgα2-WT and Itgα2-KO MMTV-PyMT organoids cultured in 3D Collagen I for three days. Insets show basal-like cells (K8 low) guiding invasive strands (Itgα2-WT) or remaining at the organoid rim (Itgα2 KO, non-invasive). (G) Mean-gray value of Inhba in basal-like cells (K8-low) located at the rim of Itgα2 WT vs. KO MMTV-PyMT organoids (3D Collagen I, day 1). Median: red lines, n =11 cells from 6 Itgα2-WT organoids, and n = 12 cells from 7 Itgα2-KO organoids from one experiment. (H) qPCR analysis showing relative mRNA expression of CTGF in MMTV-PyMT Itgα2-KO organoids compared to Itgα2-WT organoids treated with Activin A ligand (20 ng/μl) or vehicle control (0.1% BSA) for three days. Bar graph represents mean normalized expression values (relative to housekeeping genes) ± SD from four independent experiments. (I) Kaplan-Meier plot correlating ITGB1 gene expression with DMFS in grade 3 breast cancer patients. Scale bars: 50 μm (C, F), 25 μm (C, F, Zoom in). P values, two-sided unpaired Mann–Whitney test (E, G), two-sided Kruskal-Wallis test (Dunn’s multiple comparison) (H), Logrank test (I).

Article Snippet: The following antibodies were used: rabbit anti-human Vimentin (Cat#ab92547, Abcam), chicken anti-human Vimentin (Cat#PA1-16759, Invitrogen) rabbit anti-human Keratin 14 (Cat# 905301, Biolegend), rat anti-mouse Keratin 8 (Cat# 531826, DSHB), rabbit anti-rat Collagen I cleavage site (Col ¾, Cat#0217-025, immunoGlobe), rabbit anti-human integrin α2 (Cat#ab181548, Abcam), rabbit anti-human Inhba (Cat#10651-1-AP, Proteintech), Mouse IgG1 isotype control (MAB002, R&D Systems), anti-Activin A antibody (Cat#AF338, R&D Systems).

Techniques: Sequencing, Gene Knockout, CRISPR, Western Blot, Expressing, Imaging, Knock-Out, Cell Culture, Control, Gene Expression, MANN-WHITNEY, Comparison

Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of the loss-of-function metastasis screen using the mouse genome-scale CRISPR/Cas9 knock-out library (mGeCKOa).

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: CRISPR, Knock-Out

Journal: Cell

Article Title: Genome-wide CRISPR screen in a mouse model of tumor growth and metastasis

doi: 10.1016/j.cell.2015.02.038

Figure Lengend Snippet: (A) Schematic representation of lentiviral transduction of Cas9-GFP KPD cells with single sgRNAs designed to target one gene or miR. After puromycin selection, the cell population was transplanted into Nu/Nu mice and also deep sequenced to examine the distribution of indels at the target site. After 5 weeks, the primary tumor and lungs are examined.

Article Snippet: Pooled guide-only library cloning and viral production The Cas9-GFP KPD cell line was transduced at a MOI of ~ 0.4 with a genome-wide lentiviral mouse CRISPR knockout guide-only library ( Sanjana et al., 2014 ) containing 67,405 sgRNAs (mGeCKOa, Addgene 1000000053) with at least 400-fold representation (cells per construct) in each infection replicate.

Techniques: Transduction, Selection

Journal: Cell reports

Article Title: MCK2-mediated MCMV infection of macrophages and virus dissemination to the salivary gland depends on MHC class I molecules.

doi: 10.1016/j.celrep.2023.112597

Figure Lengend Snippet: Figure 2. Neuropilin 1 (Nrp1) and CX3CR1 do not mediate MCK2-dependent MCMV infection of macrophages (A) Representative flow cytometry histograms plots of Nrp1 levels on NIH/3T3 fibroblasts or RAW 264.7 monocyte/macrophage cells without nucleofection or nucleofected with CRISPR-Cas9 ribonucleoparticles targeting Nrp1 (Nrp1 RNPs). (B) Quantification of mCherry signal at 20 hpi with indicated MCMV strains at MOI of 1 from cells treated with control (Ctrl.) RNPs or Nrp1 RNPs. (C) Representative flow cytometry histograms plots of CX3CR1 levels on NIH/3T3 fibroblasts or RAW 264.7 monocyte/macrophage cells that were nucleofected with Ctrl. or CX3CR1 RNPs. (D) Quantification of mCherry signal at 20 hpi with MCMV-3DR at MOI of 1 from cells treated with Ctrl. RNPs or CX3CR1 RNPs. (E) Quantification of mCherry signal at 20 hpi with MCMV-3D or -3DR at MOI of 1 from alveolar macrophages collected by bronchoalveolar lavage from wild-type (WT) or Cx3cr1/ mice. (B and D) Data are from 3–4 independent experiments. One dot equals a mean of the triplicates from one experiment, line at mean value per group. (E) Data are from 2 experiments with 5–6 animals per group (dots), and line represents mean value per group. (C–E) Statistical analysis: one-way ANOVA test followed by Sidak’s multiple comparison test; ns, not significant; **p < 0.01, ***p < 0.001, ****p < 0.0001.

Article Snippet: Next, SpCas9-expressing Nrp1 / NIH/3T3 fibroblasts were then transduced with the Mouse Brie CRISPR knockout lentiviral prep (Addgene #73633-LV) as described previously.48,49 Next, two biological replicates of cells expressing mouse Brie library were infected with MCK2+ MCMV-3DR at MOI 10.

Techniques: Infection, Cytometry, CRISPR, Control, Comparison

Journal: Cell reports

Article Title: Upregulation of exosome secretion from tumor-associated macrophages plays a key role in the suppression of anti-tumor immunity.

doi: 10.1016/j.celrep.2023.113224

Figure Lengend Snippet: Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Article Snippet: Murine TNF-a: 50-GGTGCCTATGTCTCAGCCTCTT-30 and 50-GCCATAGAA CTGA TGAGAGGGAG-3’; Murine IL-1b: 50- TGGACCTTCCAGGATGAGGACA-3’; Murine IL-6: 50-T ACCACTTCACAAGTCG GAGGC-30 and 50- CTGCAAGTGCATCA TCGTTG TTC-3’; TGF-b: 50-TGATACGCCTGAGTGGCTGTCT-3’; GAPDH: 50-CATCACT GCCACC CAGAAGACTG-30 and 50-ATGCCAGTGAGCTTCCCGTTCAG-3’. shRNA knockdown and CRISPR-Cas9 knockout shRNAs against human RAB27A (NM_004850, GCTGCCAATGGGACAAACATA, CAGGAGAGGTTTCGTAGCTA),96 mouse RAB27A (NM_001301230.1, CGAAACTGGATAA GCCAGCTA, GACAAACATAAGCCACGCGAT), human MADD (NG_029462.1, CCACAAGT ACAAGACGCCAAT, CCTGAAAGTATTTGGGCTAAA), mouse MADD (NM_001177720.1, CCACAAGTACAAGACGCCAAT, CCGCTCATTTATGGCAATGAT) or scrambled shRNA (Addgene, Catalog Number:1864) were co-transfected with viral packaging plasmids to package lentiviral particles using HEK293T cells.

Techniques: Expressing, Clinical Proteomics

Journal: bioRxiv

Article Title: Catalytic-independent functions of INTAC in conferring sensitivity to BET inhibition

doi: 10.1101/2024.02.07.579305

Figure Lengend Snippet: (A) Flow chart of the genome-wide CRISPR screening conducted to enrich cells with acquired resistance to BET inhibition in Eμ-Myc cells with the stable expression of Cas9. (B) Rank plot showing the log2 fold change (JQ1 versus DMSO) of sgRNA reads in survived cells post JQ1 treatment. Top ten enriched sgRNA targets and genes encoding INTAC complex labeled in color. (C) Schematic of the INTAC complex, components of the auxiliary module are highlighted. (D) Western blotting for INTS10, INTS13, INTS14 and INTS15 in CRISPR knockout Eμ-Myc cells. β-actin is a loading control. (E) Cell survival assays in sgCtr, sgINTS10, sgINTS13, sgINTS14 and sgINTS15 Eμ-Myc cells treated with DMSO or JQ1. (F) Western blotting for INTS1, INTS8 and INTS11 in CRISPR knockout Eμ-Myc cells. (G) Cell survival assays in sgCtr, sgINTS1, sgINTS8 and sgINTS11 Eμ-Myc cells treated with DMSO or JQ1. (H) Measurement for transcription termination of the representative snRNAs Rnu1a1 and Rnu3b2 in sgCtr, sgINTS15, sgINTS10, sgINTS8 and sgINTS11 Eμ-Myc cells. (I) Western blotting for RNA Pol II phosphorylation levels at carboxyl-terminal domain (CTD) Serine 5 (pSer5) and Serine 2 (pSer2) in sgCtr, sgINTS15, sgINTS10, sgINTS8 and sgINTS11 Eμ-Myc cells. β-actin is a loading control. See also Figure S1.

Article Snippet: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli.

Techniques: Genome Wide, CRISPR, Inhibition, Expressing, Labeling, Western Blot, Knock-Out, Control, Phospho-proteomics